|
|
|
|
Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada
Received January 3, 2003; accepted April 10, 2003
| Abstract |
|---|
|
|
|---|
, but not the
TP
, isoform of the receptor, and that these cells secrete in response to
the thromboxane A2 (TP) receptor agonist
9,11-dideoxy-9
,11
-methanoepoxy-prostaglandin
F2
(U-46619). However, although part of the
response seems to mediated via TP receptors, there are significant
nonTP receptor-mediated effects on both the apical and basolateral
membranes of Calu-3 cells. This is the first report of an isoprostane
eliciting an effect in airway epithelial cells and suggests a potential role
for this class of molecules in pulmonary host defense.
To date, no studies have been performed investigating the effects of
isoprostanes on airway epithelial cells, although these cells will be exposed
to incidents of oxidant stress in vivo. We have recently reported that
H2O2 stimulates transepithelial anion secretion across
intact monolayers of the human airway epithelial cell line Calu-3
(Cowley and Linsdell, 2002a
).
Calu-3 cells have become a widely used model of human airway submucosal gland
serous cells (Shen et al.,
1994
; Moon et al.,
1997
; Cowley and Linsdell,
2002a
,b
).
In vivo submucosal gland serous cells play a crucial role in maintaining a
sterile environment in the airways because they secrete a number of
antimicrobial compounds, such as lysozyme, lactoferrin, secretory protease
inhibitor, and secretory IgA (Basbaum et
al., 1990
). Essentially, they also maintain effective mucociliary
clearance, because they are responsible for the glandular secretion of salt
and water (Pilewski and Frizzell,
1999
), hydrating mucus as it is secreted from mucous cells, and
regulating the volume of the airway surface liquid lining the respiratory
epithelial cells. In vitro, Calu-3 cells retain several of the markers of
serous cell function, secreting antimicrobials and demonstrating active
transepithelial anion secretion in response to a number of pharmacological
stimuli that raise intracellular cAMP or Ca2+ concentrations
(Shen et al., 1994
;
Moon et al., 1997
). Serous
cells also express the highest levels of the cystic fibrosis transmembrane
conductance regulator (CFTR) Cl- channel
(Engelhardt et al., 1992
),
mutations in which result in CF. Indeed, the high degree of CFTR expression in
the serous cell in relation to other airway cell types has led to the proposal
that these cells represent the primary site of CF pathology
(Pilewski and Frizzell,
1999
).
Thus, we now sought to investigate whether isoprostanes, potentially produced during airway inflammation when H2O2 acts on arachidonic acid in the airways, elicit a biological effect on Calu-3 cells, a human airway epithelial cell line, and how those effects are mediated.
| Materials and Methods |
|---|
|
|
|---|
Permeabilized Monolayers. To investigate the activity of apical
Cl- and basolateral K+ channels in isolation, the
opposite membrane was permeabilized by addition of 180 µg/ml nystatin
(Sigma, Oakville, ON, Canada) in the presence of appropriate buffers
(Cowley and Linsdell, 2002a
).
Thus, apical Cl- conductance was studied in the presence of a
serosal to mucosal Cl- gradient with the following bath solutions:
apical, 145 mM Na-gluconate, 3.3 mM NaH2PO4, 0.8 mM
Na2HPO4, 1.2 mM Mg(gluconate)2, 4 mM
Ca(gluconate)2, 10 mM glucose, and 10 HEPES; basolateral, 145 mM
NaCl, 3.3 mM NaH2PO4, 0.8 mM
Na2HPO4, 1.2 mM MgCl2, 1.2 mM
CaCl2, 10 mannitol, and 10 mM HEPES.
Basolateral K+ channels were studied by permeabilization of the apical membrane in the presence of a mucosal to serosal K+ gradient established by the following bath solutions: apical, 145 mM K-gluconate, 3 mM KH2PO4, 0.8 mM K2HPO4, 1.2 mM Mg(gluconate)2, 4 mM Ca(gluconate)2, 10 mM glucose, and 10 mM HEPES; basolateral, 145 mM Na-gluconate, 3.3 mM NaH2PO4, 0.8 mM Na2HPO4, 1.2 mM Mg(gluconate)2, 4 mM Ca(gluconate)2, 10 mM glucose, and 10 mM HEPES. All solutions were pH 7.4 at 37°C.
RNA Extraction. Total RNA was extracted from Calu-3s cells using TRIzol reagent (Invitrogen, Burlington, ON, Canada). RNA was then DNase-treated with RQ1 RNase-free DNase (Promega, Madison, WI), and the product was run on a 1% agarose gel to check integrity. DNase-treated RNA (2 µg) was then reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Invitrogen) in the presence of 5 mM dNTP and 1 µM oligo(dT) (Amersham Biosciences, Baie d'Urfe, PQ, Canada) to produce cDNA.
Polymerase Chain Reaction. After reverse transcription, PCR was
performed to amplify DNA fragments using the primers described by Miggin and
Kinsella (1998
). A common
primer (5' GAGATGATGGCTCAGCTCCT 3') was used to look for both TP
isoforms, whereas different primers were used to distinguish between the
TP
(5' CCAGCCCCTGAATCCTCA 3') and TP
isoforms
(5' AGACTCCGTCTGGGCCG 3'). All custom primers were obtained from
Invitrogen (Burlington, ON, Canada), and reactions were performed using primer
pairs at 10 µM with 2.5 units of Taq polymerase (MBI Fermentas,
Burlington, ON, Canada), 25 mM MgCl2, and 5 mM dNTP in a total
reaction volume of 25 µl. The amplification conditions were: denaturation
at 95°C for 1 min, annealing at 58°C for 30 s, and elongation at
72°C for 3 min. PCR products were visualized by loading a 8-µl sample
on a 1.5% agarose gel containing 250 µg/l ethidium bromide, alongside a
100-base pair DNA ladder (Invitrogen).
DNA Sequencing. To confirm the identity of the amplified PCR fragments, the product was isolated from the gel using the QIAquick gel extraction kit (QIAGEN, Mississauga, ON, Canada). DNA was then ligated into the pGEM vector (Promega), propagated in Escherichia coli strain JM109 and sequenced using the Sequenase DNA sequencing kit (U.S. Biochemical, Cleveland, OH).
Chemicals. 8-iso-Prostaglandin E2, 8-iso-prostaglandin
F2
, SQ 29,548 and U-46619 were obtained from Caymen Chemical
(Ann Arbor, MI). Diphenylamine-2-carboxylate (DPC), nystatin,
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS),
clotrimazole, and clofilium tosylate were obtained from Sigma Aldrich
(Oakville, ON, Canada). The cell-permeable protein kinase A inhibitor
1422 amide, myristoylated, and chelerythrine chloride and BAPTA-AM were
from Calbiochem (San Diego, CA). Stock solutions of the isoprostanes, DPC, and
clotrimazole were made up in ethanol, whereas nystatin, DIDS, SQ 29,548,
U-46619, clofilium, and the protein kinase A (PKA) inhibitor were made up in
dimethyl sulfoxide so that the final bath concentration of solvent was
0.1%. DIDS was made up in buffer. Application of dimethyl sulfoxide or
ethanol alone had no effects upon the monolayers.
Statistics. All data are presented as means ± S.E.M. Differences between groups were tested for statistical significance using the Student's t test or one-way analysis of variance followed by a Bonferroni t test where appropriate. Significance was determined as p < 0.05.
| Results |
|---|
|
|
|---|
|
The addition of 8-iso-PGF2
to the basolateral
aspect of cells did increase Isc, although to a much lesser extent
than 8-iso-PGE2 (Fig
1E). When 8-iso-PGF2
was added
apically, the increase in Isc was also minor compared with
8-iso-PGE2. Because 8-iso-PGE2 produced a much larger
increase in Isc than 8-iso-PGF2
(Fig. 1) we went on to
investigate the mechanism of the 8-iso-PGE2 response in more
detail. 300 nM 8-iso-PGE2 was chosen as the dose for all subsequent
investigations. The increase in Isc recorded when 300 nM
8-iso-PGE2 was applied to the basolateral side of Calu-3 cells was
47.2 ± 2.5 µA/cm2 (n = 9) compared with 24.4
± 1.7 µA/cm2 (n = 4) for apical application. For
comparison, 300 nM 8-iso-PGF2
applied
basolaterally produced an increase in Isc of 4.7 ± 1.1
µA/cm2 (n = 3), whereas no increase could be detected
for the same dose applied apically.
EC50 values were determined as 53 and 160 nM for
8-iso-PGE2 applied to the basolateral and apical sides,
respectively, whereas 8-iso-PGF2
had an
EC50 of 300 nM for basolateral application. The dose-response
curves in Fig. 1, D and E, show
a supramaximal decline to the agonist. This may well reflect some degree of
desensitization, or it may be that at the higher concentrations, additional
receptor types are recruited in a nonspecific manner, some of which act to
inhibit secretion in these cells.
Effect of Chloride Channel Inhibitors on the
8-iso-PGE2Mediated Increase in Isc across Calu-3
Monolayers. Both basal and stimulated anion secretion from Calu-3 cells
has previously been shown to be dependent upon the activity of CFTR
Cl- channels (Shen et al.,
1994
; Singh et al.,
1997
; Moon et al.,
1997
; Cowley and Linsdell
2002a
). To investigate whether the
8-iso-PGE2mediated increase in Isc seen across
monolayers of Calu-3 cells was dependent upon CFTR, we examined the effect of
the Cl- channel inhibitors DPC and DIDS
(Schultz et al., 1999
). When
0.5 mM DPC was applied to the apical side of the monolayers after 300 nM
8-iso-PGE2, the secretory response was immediately inhibited
(Fig. 2A). Furthermore, when
0.5 mM DPC was applied before the isoprostane
(Fig. 2B), the basal
Isc was initially inhibited, and the subsequent increase in
Isc to 300 nM 8-iso-PGE2 was significantly reduced to
6.5 ± 1.2 µA/cm2 (n = 3) or 13% of the control
response (Fig. 2C). In
contrast, prior application of the disulfonic stilbene DIDS (250 µM) had no
effect on the magnitude of the response to 300 nM 8-iso-PGE2 (48.1
± 5.2 µA/cm2, n = 6,
Fig. 2C). Although DIDS
inhibits a variety of Cl- channels
(Schultz et al., 1999
), CFTR
is insensitive to extracellularly applied DIDS. This combination of
sensitivity to DPC and insensitivity to DIDS suggests that the anion secretion
in response to 8-iso-PGE2 may be mediated via CFTR, and a further
series of experiments was performed to investigate the PKA-dependence of the
channel mediating the 8-iso-PGE2 response.
|
Effect of 8-iso-PGE2 on Apical Cl-
Conductance. To further examine the mechanism of the increase in
transepithelial anion secretion in response to this isoprostane, we isolated
the apical membrane Cl- conductance by permeabilizing the
basolateral membrane with the pore-forming antibiotic nystatin in the presence
of a serosal-to-mucosal Cl- gradient. Addition of 300 nM
8-iso-PGE2 to the apical face of the permeabilized monolayers
resulted in an increase in Isc of 46.4 ± 1.6
µA/cm2, n = 5 (Fig.
3A), which under these conditions represents increased efflux of
Cl- ions across the apical membrane down their concentration
gradient. Again, this increase in Isc was insensitive to DIDS (250
µM) applied to the extracellular aspect of the membrane but inhibitable by
DPC (0.5 mM; Fig. 3A,
n = 4). To investigate the mechanism responsible for the increase in
apical membrane Cl- conductance (GCl), we used an
inhibitor of protein kinase A, PKA inhibitor 1422 amide, because the
activity of CFTR is known to be regulated via the PKA/cAMP pathway
(Sheppard and Welsh, 1999
).
Monolayers of Calu-3 cells were incubated in 10 µM PKA inhibitor
1422 amide, myristoylated for 60 min, after which the basolateral
membrane was permeabilized by the addition of nystatin. Under these
conditions, the subsequent application of 300 nM 8-iso-PGE2 to the
apical aspect of the membrane did not result in an increase in the
Isc (Fig.
3B; n = 4).
|
An additional series of experiments was undertaken to investigate whether the response to 8-iso-PGE2 was mediated via increases in intracellular Ca2+ and the protein kinase C (PKC) pathway. Preincubation of cells with 50 µM of the Ca2+ chelator BAPTA-AM before permeabilization of the basolateral membrane with nystatin had no effect on the magnitude of the subsequent response to 300 nM 8-iso-PGE2 (mean increase in Isc = 44.1 ± 7.7 µA/cm2; n = 3, Fig. 3C). Furthermore, the possible involvement of PKC was investigated by preincubating cells for 60 min with the PKC inhibitor chelerythrine chloride (mean increase in Isc = 10 µM; 45. 2 ± 2.0 µA/cm2; n = 3, Fig. 3D.) Thus, we are able to conclude that the 8-iso-PGE2mediated increase in GCl is dependent on the PKA pathway, whereas we can find no evidence that the PKC pathway is involved.
Effect of 8-iso-PGE2 on Basolateral K+
Conductance. To isolate basolateral K+ conductance, the
apical membrane was permeabilized with nystatin in the presence of
Cl--free buffers to establish a mucosal to serosal K+
gradient. Under these conditions, application of 300 nM 8-iso-PGE2
to the basolateral side of the monolayers produced a transient increase in
Isc of 24.2 ± 2.8 µA/cm2, n = 5
(Fig. 4, A and B), which
reflects an increase in K+ conductance (GK). We have
previously demonstrated that agonist-stimulated secretion across Calu-3
monolayers can be inhibited by the K+ channel inhibitors clofilium
and clotrimazole, agents that probably inhibit the KvLQT1 and
Ca2+-activated hSK4 (or hIK) channels present in these cells and
are encoded by the genes KCNQ1 and KCNN4, respectively
(Cowley and Linsdell, 2002b
).
In cell monolayers pretreated with 30 µM clotrimazole before the addition
of 300 nM 8-iso-PGE2, the increase in Isc was only 5.8
± 0.8 µA/cm2 (Fig.
4B; n = 4), or approximately 24% of the control value.
The addition of 100 µM clofilium also significantly reduced the subsequent
response to 8-iso-PGE2, this time to 12.8 ± 2.8
µA/cm2 (Fig.
4B, n = 4) or 52% of control values. It seems
that the major component of the increase in GK we see in response
to 8-iso-PGE2 is probably mediated via a clotrimazole-sensitive
channel, probably Ca2+-activated K+ channel hSK4,
whereas the clofilium-sensitive channels such as KvLQT1 seem less
important.
|
Mechanism of 8-iso-PGE2 Action. There is evidence that
8-iso-PGE2 (and 8-iso-PGF2
) may
achieve their effects via binding to the thromboxane A2 (TP)
receptor (Elmhurst et al.,
1997
; Sametz et al.,
2000
; Janssen,
2001
; Kinsella,
2001
). However, there are also reports suggesting that unique
isoprostane-selective receptors may exist
(Longmire et al., 1994
).
Presently, it is unclear which receptor types could be responsible for the
effects of 8-iso-PGE2 that we see in Calu-3 cells. To investigate
whether the TP receptor could be mediating this effect, we first examined
whether the response to 8-iso-PGE2 could be inhibited by SQ 29,548,
a specific TP receptor antagonist
(Fukunaga et al., 1993
;
Elmhurst et al., 1997
).
Application of 10 µM SQ 29,548 10 min before the addition of 300 nM
8-iso-PGE2 significantly reduced the increase in Isc
when the isoprostane was applied to the apical (35% of control, n =
3; Fig. 5A) but not the
basolateral (n = 6; Fig.
5B) side of the Calu-3 monolayers.
|
To establish the presence of functional TP receptors on Calu-3 cells, we
next used a specific thromboxane A2 mimetic, U-46619
(Walsh and Kinsella, 2000
;
Janssen and Tazzeo, 2002
).
Addition of 3 µM U-46619 to both sides of intact monolayers of Calu-3 cells
stimulated an increase in Isc (22.9 ± 2.0
µA/cm2; Fig.
5C; n = 3), indicating that functional TP
receptors are indeed present on Calu-3 cells. Application of the TP receptor
agonist to either the apical or the basolateral face stimulated an increase in
Isc, suggesting that TP receptors are present on both sides of the
monolayers. Basolateral application of 3 µM U-46619 increased
Isc by 11.46 ± 2.1 µA/cm2 (n = 4),
whereas apical application increased Isc by 10.86 ± 1.7
µA/cm2.
Two isoforms of the TP receptor have been described, TP
and
TP
, both members of the G-protein-coupled receptor superfamily that
differ with regard to their C termini
(Narumiya et al., 1999
;
Kinsella, 2001
). Using
specific primers designed to distinguish between these two splice variants
(Miggin and Kinsella, 1998
),
we performed RT-PCR on total RNA extracted from confluent cultures of Calu-3
cells (Fig. 5D). We
were able to detect a 400-base pair fragment of the TP
isoform and were
unable to detect the TP
isoform (expected fragment size was 269 base
pairs). The band detected using the TP
-specific primers was excised,
subcloned into the pGEM vector, and sequenced to confirm its identity.
Comparison of the sequence produced with the published sequence (National
Center for Biotechnology Information) confirmed 100% identity with the human
TP receptor (NCBI accession number XM0476330).
To further investigate the mode of action of U-46619 in Calu-3 cells and compare this with the effects of 8-iso-PGE2, permeabilized monolayers were used to investigate the second-messenger pathways responsible for its secretory effect. Again, monolayers were preincubated for 60 min in the presence of the either PKA inhibitor 1422 amide (10 µM) or the PKC inhibitor chelerythrine chloride (10 µM). After incubation, the basolateral membrane was permeabilized by the addition of nystatin, and the GCl was recorded in response to 3 µM U-46619. A typical response to U-46619 is shown in Fig 6A. Preincubation with the PKA inhibitor 1422 amide virtually abolished the response to U-46619 (Fig. 6B; n = 3), as did incubation with chelerythrine chloride (Fig. 6C; n = 3).
|
| Discussion |
|---|
|
|
|---|
To date, there has only been one report of the effect of isoprostanes on
epithelial tissue (Elmhurst et al.,
1997
), despite the potential importance of the epithelium in
mediating responses to oxidant stress. This found application of
8-iso-PGE2 to the serosal (basolateral) side of epithelial sheets
from canine proximal colon induced dose-dependent increases in the
Isc. We report here that 8-iso-PGE2 also increases
Isc measured across cultured monolayers of a human airway
epithelial cell line, Calu-3, a widely used and accepted model of the human
submucosal gland serous cell (Shen et al.,
1994
; Moon et al.,
1997
; Cowley and Linsdell,
2002a
,b
).
The most widely studied isoprostanes have been 8-iso-PGE2 and
8-iso-PGF2
; therefore, these are the molecules we
chose to investigate. We found that 8-iso-PGE2 stimulates anion
secretion from Calu-3 cells measured as an increase in Isc. For any
given concentration, the increase in Isc was always larger when
8-iso-PGE2 was applied to the basolateral compared with the apical
side of the cells (Fig. 1). In
contrast, application of 8-iso-PGF2
produced only
very small increases in Isc even at large doses
(Fig. 1E), and was not
subsequently investigated further.
The increase in Isc seen in response to 8-iso-PGE2
was almost entirely inhibited by DPC (Figs.
2 and
3A) and unaffected by the
disulfonic stilbene DIDS (Figs.
2C and
3A). This DPC sensitivity and
DIDS insensitivity suggests that the increases we are seeing are mediated via
the activation of CFTR. However, DPC is far from a specific inhibitor of CFTR,
and this result does not entirely rule out the involvement of another
Cl- channel type. Therefore, we further investigated the role of
PKA in mediating this response, because CFTR activity in Calu-3 cells is
regulated by PKA activity (Cobb et al.,
2002
). Preincubation with the PKA inhibitor 1422 amide
abolished the apical membrane increase in GCl in response to
8-iso-PGE2 (Fig. 3B)
and is additional evidence that we are looking at a CFTR-mediated response.
Furthermore, we could find no evidence that the PKC pathway is involved in
mediating the response to 8-iso-PGE2, because the increase in
GCl was unaffected by either the Ca2+ chelator BAPTA-AM
or the PKC inhibitor chelerythrine chloride.
In addition to stimulating apical GCl, 8-iso-PGE2
also stimulated GK across the basolateral membrane of Calu-3 cells,
an increase that was significantly reduced by the K+ channel
blockers clofilium and clotrimazole (Fig.
4B). Halm and Halm
(2001
) reported that
8-iso-PGE2 stimulated K+ secretion across guinea pig
distal colon, although the K+ channels responsible were not
investigated. Clofilium inhibits the cAMP-activated K+ channel
KvLQT1, whereas clotrimazole inhibits the Ca2+-activated
K+ channel hSK4 (or hIK), both previously demonstrated to be
present in Calu-3 cells (Cowley and
Linsdell, 2002b
.) At the dose used (100 µM), we cannot be
certain that clofilium is acting exclusively to inhibit only KvLQT1; it may
well be that other K+ channel types are inhibited, because the
entire complement of K+ channels in Calu-3 cells has not been
described. However, the overall effect of opening basolateral K+
channels would be to increase anion secretion across the apical membrane,
because this K+ exit would hyperpolarize the cell, increasing the
electrochemical driving force for anions to leave the cell. Thus,
8-iso-PGE2 stimulation of basolateral K+ channels in
concert with the stimulation of apical CFTR would effectively maximize the
secretory response to the isoprostane. This coordinated increase in both
GCl and GK is not unique to 8-iso-PGE2;
indeed, we have found a similar result for both cAMP and
H2O2 (Cowley and Linsdell,
2002a
,b
),
suggesting that this may be a common physiological mechanism to facilitate
secretion from these cells.
The sidedness of the response to 8-iso-PGE2, in which a larger
response was always seen when agonist was applied basolaterally rather than
apically, suggests that differences exist in the receptor complement or type
available to mediate the cellular response. Although it has been proposed that
some isoprostane effects may be mediated via a unique (asyet unidentified)
isoprostane receptor (Morrow and Roberts,
1996
), many of their effects seem to be mediated via prostanoid
receptors. To date, there is evidence that 8-iso-PGE2 may act via
the TP, FP, or EP receptors depending on the tissue type
(Janssen, 2001
). We examined
whether 8-iso-PGE2 was acting via the TP receptor to mediate the
secretory response from Calu-3 cells because this receptor type has been most
widely implicated in mediating the 8-iso-PGE2 response
(Elmhurst et al., 1997
;
Sametz et al., 2000
;
Janssen, 2001
;
Kinsella, 2001
), Two isoforms,
TP
and TP
, which have been described previously
(Narumiya et al., 1999
),
differ in the length of their C termini
(Narumiya et al., 1999
;
Kinsella, 2001
).
Preapplication of the TP receptor antagonist SQ 29,548 (10 µM)
significantly reduced the apical response to 8-iso-PGE2, although
did not abolish it (Fig. 5A).
However, the same concentration of SQ 29,548 had no effect on the basolateral
response to this isoprostane (Fig.
5B). The most obvious interpretation of these results is that TP
receptors are present predominately on the apical aspect of these cells.
Furthermore, addition of U-46619, a TP receptor agonist, induced an increase
in Isc across Calu-3 cells (Fig.
5C), whereas RT-PCR revealed that Calu-3s express mRNA for the
TP
isoform of the receptor (Fig.
5D). Thus, we present functional and molecular evidence that
Calu-3 cells express TP receptors. However, application of the TP receptor
agonist induced an approximately equivalent increase in Isc when it
was applied to either the apical or the basolateral side of the cells. This is
in apparent contrast to the SQ 29,548 antagonist data suggesting that TP
receptors are present predominately apically, because it would be expected
that application of U-46619 would induce more of a response apically than
basolaterally. One possibility is that U-46619 is rapidly diffusing into and
across the monolayers of cells, so that the response we see is mediated
predominately via apical TP receptors. Alternatively, it might be that at the
concentration used (3 µM) U-46619 is not acting specifically at TP
receptors, but influencing other prostanoid receptors present on these
cells.
To further investigate how U-46619 mediates secretion from Calu-3 cells, we
looked at how PKA and PKC inhibition affected its response. Although TP
receptors are widely reported to be coupled to phospholipase C and the
elevation of intracellular Ca2+
(Kinsella, 2001
), we found
that incubation with inhibitors of either PKA or PKC abolished the response to
U-46619. Thus, in Calu-3 cells, it would seem that activation of TP receptors
affects the PKC pathway; further downstream, however, there seems to be some
complex cross-talk also leading to the activation of PKA.
Taken together, our results demonstrate that functional TP receptors are present on Calu-3 cells. However, the differences we observe in the responses to 8-iso-PGE2 and U-46619 suggest that TP receptors are, at best, only partly responsible for mediating the effects of 8-iso-PGE2 in Calu-3 cells and that other TP receptor-independent mechanisms, such as binding to additional receptor types, are probably also involved.
The major finding of this study, that 8-iso-PGE2 stimulates
transepithelial anion secretion via CFTR, has potentially important
implications for the pathogenesis of CF lung disease, because this mechanism
would not function in the CF lung. In the normal submucosal gland serous cell
in vivo, stimulated anion secretion via CFTR would be coupled to fluid
secretion. This fluid would assist clearing any infectious agents from the
airways because it would flush out and fully hydrate mucus secreted from
submucosal gland mucous cells, and it would also be rich in endogenous
antimicrobial compounds that would directly attack invading organisms
(Basbaum et al., 1990
). Thus,
the release of this fluid would assist host defense mechanisms act to rid the
airways of the initial inflammatory insult that leads to ROS production and
isoprostane generation. CF lung disease, however, is characterized by repeated
and persistent incidents of bacterial infection and consequent inflammatory
responses, which ultimately lead to tissue damage and respiratory failure. In
the absence of CFTR, this response would be absent, reducing the amount of
fluid secreted from submucosal gland serous cells and potentially exposing the
CF lung to oxidant stress for extended periods. Thus, loss of this
CFTR-mediated response could compromise the CF lung and reduce its ability to
carry out effective mucociliary clearance.
In conclusion, we here make the first report of the effects of an isoprostane, 8-iso-PGE2, on human airway epithelial cells. Isoprostanes are associated with incidents of oxidative stress, because they are produced via the action of ROS on polyunsaturated fatty acids, and elevated levels of isoprostanes have been recorded in a wide variety of inflammatory lung diseases. Because human airways are constantly exposed to instances of oxidant stress, resulting both from the inhalation of foreign material as well as the production of ROS by activated inflammatory cells, it is likely that airway epithelial cells are exposed to elevated levels of isoprostanes. 8-iso-PGE2stimulated transepithelial anion secretion across monolayers of Calu-3 cells via concerted effects at apical CFTR Cl- channels and basolateral K+ channels. Stimulation of both channel types would maximize the secretory response from the cells, which we propose would help flush the airways of the agent responsible for producing the oxidant stress. Furthermore, our finding that this process is CFTR-mediated suggests that this response to isoprostanes (and oxidant stress in general) would be absent in the CF lung, reducing the effectiveness of host defense mechanisms and potentially exposing the CF lung to extended periods of oxidant stress. This is the first report of an isoprostane eliciting an effect in airway epithelial cells, and suggests a potential role for this class of molecules in pulmonary host defense.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: CF, cystic fibrosis; ROS, reactive oxygen species;
CFTR, cystic fibrosis transmembrane conductance regulator; PCR, polymerase
chain reaction; SQ 29,548,
[1S-[1a,2a(Z),3a,4a]]-7-[3-[[2-[(phenylamino)carbonyl]hydrazino]methyl]-7-oxabicyclo(2.2.1)hept-2-yl]-5-heptenoic
acid; U-46619, 9,11-dideoxy-9
,11
-methanoepoxy-prostaglandin
F2
; DPC, diphenylamine-2-carboxylate; DIDS,
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; BAPTA,
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic
acid; PKA, protein kinase A; PG, prostaglandin; PKC, protein kinase C; RT,
reverse transcription.
Address correspondence to: Elizabeth Cowley, Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia B3H 4H7, Canada. E-mail: elizabeth.cowley{at}dal.ca
| References |
|---|
|
|
|---|
Catalli A, Zhang D, and Janssen LJ (2002) Receptors and signalling pathway underlying relaxations to isoprostanes in canine and porcine airway smooth muscle. Am J Physiol 283: L1151L1159.
Cobb BR, Ruiz F, King CM, Fortenberry J, Greer H, Kovacs T, Sorscher EJ, and Clancy JP (2002) A2 adenosine receptors regulate CFTR through PKA and PLA2. Am J Physiol 282: L12L25.
Cowley EA and Linsdell P (2002a) Oxidant stress
stimulates anion secretion from the human airway epithelial cell line Calu-3:
implications for cystic fibrosis lung disease. J
Physiol 543:
201209.
Cowley EA and Linsdell P (2002b) Characterization of
basolateral K+ channels underlying secretion in the human airway
cell line Calu-3. J Physiol
538:
747757.
Dworski R (2000) Oxidant stress in asthma. Thorax 55 Suppl 2: S51S53.[Medline]
Elmhurst JL, Betti PA, and Rangachari PK (1997)
Intestinal effects of isoprostanes: evidence for the involvement of prostanoid
EP and TP receptors. J Pharmacol Exp Ther
282:
11981205.
Engelhardt JF, Yankaskas JR, Ernst SA, Yang Y, Marino CR, Boucher RC, Cohn JA, and Wilson JM (1992) Submucosal glands are the predominant site of CFTR expression in the human bronchus. Nat Gen 2: 240248.[CrossRef][Medline]
Fam SS, Murphey LJ, Terry ES, Zackert WE, Chen Y, Gao L, Pandalai S, Milne GL, Roberts LJ, Porter NA, et al. (2002) Formation of highly reactive A-ring and J-ring isoprostane-like compounds (A4/J4-neuroprostanes) in vivo from docosahexaenoic acid. J Biol Chem 277: 2607636084.
Fukunaga M, Yura T, and Badr KF (1992) Stimulatory
effect of 8-epi-PGF2
, an F2-isoprostane, on endothelin-1 release.
J Cardiovasc Pharmacol
26:
S51S52.
Fukunaga M, Takahashi K, and Badr KF (1993) Vascular smooth muscle actions and receptor interactions of 8-isoprostaglandin E2, an E2-isoprostane. Biochem Biophys Res Commun 195: 507515.[CrossRef][Medline]
Halm DR and Halm ST (2001) Prostanoids stimulate K secretion and Cl secretion in guinea pig distal colon via distinct pathways. Am J Physiol 281: G984G996.
Janssen LJ (2001) Isoprostanes: an overview and putative roles in pulmonary pathophysiology. Am J Physiol 280: L1067L1082.
Janssen LJ, Premji M. Netherton S, Catalli A, Cox G, Keshavjee S
and Crankshaw DJ (2000) Excitatory and inhibitory actions of
isoprostanes in human and canine airway smooth muscle. J Pharmacol
Exp Ther 295:
506511.
Janssen LJ, Premji M, Netherton S, Coruzzi J, and Cox PG (2001) Vasoconstrictor actions of isoprostanes via tyrosine phosphorylation and Rho kinase in human and canine pulmonary vascular smooth muscles. Br J Pharmacol 132: 127134.[CrossRef][Medline]
Janssen LJ and Tazzeo T (2002) Involvement of TP and
EP3 receptors in vasoconstrictor responses to isoprostanes in pulmonary
vasculature. J Pharmacol Exp Ther
301:
10601066.
Kinsella BT (2001) Thromboxane A2 signalling in humans: a "tail" of two receptors. Biochem Soc Trans 29: 641654.[CrossRef][Medline]
Kobzar G, Mardla V, Järving I, Samel N, and Löhmus M (1997) Modulatory effect of 8-iso-PGE2 on platelets. Gen Pharmacol 28: 317321.[Medline]
Lamb NJ, Gutteridge JM, Baker C, Evans TW and Quinlan GJ (1999) Oxidative damage to proteins of bronchoalveolar lavage fluid in patients with acute respiratory distress syndrome: evidence for neutrophil-mediated hydroxylation, nitration and chlorination. Crit Care Med 27: 17381744.[CrossRef][Medline]
Leitinger N, Blazek I, and Sinzinger H (1997) The influence of isoprostanes on ADP-induced platelet aggregation and cyclic AMP-generation in human platelets. Thromb Res 86: 337342.[CrossRef][Medline]
Longmire AW, Roberts LJ, and Morrow JD (1994) Actions of the E2-isoprostane, 8-iso-PGE2, on the platelet thromboxane/endoperoxide receptor in humans and rats: additional evidence for the existence of a unique isoprostane receptor. Prostaglandins 48: 247256.[CrossRef][Medline]
Miggin SM and Kinsella BT (1998) Expression and tissue
distribution of the mRNAs encoding the human thromboxane A2
receptor (TP)
and
isoforms. Biochim Biophys
Acta 1425:
543559.[Medline]
Montuschi P, Ciabattoni G, Paredi P, Pantelidis P, du Bois RM,
Kharitonov SA, and Barnes PJ (1998) Exhaled 8-isoprostane as a
biomarker of oxidative stress in interstitial lung diseases. Am J
Respir Crit Care Med 158:
15241527.
Montuschi P, Collins JV, Ciabattoni G, Lazzeri N, Corradi M,
Kharitonov SA, and Barnes PJ (2000a) Exhaled 8-isoprostane as an
in vivo biomarker of lung oxidative stress in patients with COPD and healthy
smokers. Am J Respir Crit Care Med
162:
11751177.
Montuschi P, Corradi M, Ciabattoni G, Nightingale J, Kharitonov SA,
and Barnes PJ (1999) Increased 8-isoprostane, a marker of
oxidative stress, in exhaled breath condensates of asthma patients.
Am J Respir Crit Care Med
160:
216220.
Montuschi P, Kharitonov SA, Ciabattoni G, Corradi M, van Rensen L,
Geddes DM, Hodson ME, and Barnes PJ (2000b) Exhaled 8-isoprostane
as a new noninvasive biomarker of oxidative stress in cystic fibrosis.
Thorax 55:
205209.
Moon S, Singh M, Krouse ME, and Wine JJ (1997) Calcium-stimulated Cl- secretion in Calu-3 human airway cells requires CFTR. Am J Physiol 273: L1208L1219.
Morrow JD, Hill KE, Burk RF, Nammour TM, Badr KF, and Roberts LJ
(1990) A series of prostaglandin F2-like compounds are produced
in vivo in humans by a non-cyclooxygenase, free radical-catalyzed mechanism.
Proc Natl Acad Sci USA
87:
93839387.
Morrow JD and Roberts LJ (1996) The isoprostanes. Current knowledge and directions for future research. Biochem Pharmacol 51: 19.[CrossRef][Medline]
Narumiya S, Sugimoto Y, and Ushikubi F (1999)
Prostanoid receptors: structures, properties and functions. Physiol
Rev 79:
11931225.
Pilewski JM and Frizzell RA (1999) Role of CFTR in airway disease. Physiol Rev 79: S215S255.
Repine JE, Bast A, and Lankhorst I (1997) Oxidative
stress in chronic obstructive pulmonary disease. Am J Respir Crit
Care Med 156:
341357.
Sametz W, Hennerbichler S, Glaser S, Wintersteiger R, and Juan H
(2000) Characterization of prostanoid receptors mediating actions
of the isoprostanes, 8-iso-PGE2 and
8-iso-PGF2
, in some isolated smooth muscle
preparations. Br J Pharmacol
130:
19031910.[CrossRef][Medline]
Schultz BD, Singh AK, Devor DC, and Bridges RJ (1999) Pharmacology of CFTR chloride channel activity. Physiol Rev 79: S109S144.
Shen B-Q, Finkbeiner WE, Wine JJ, Mrsny RJ, and Widdicombe JH (1994) Calu-3: a human airway epithelial cell line that shows cAMP-dependent Cl- secretion. Am J Physiol 266: L493L501.
Singh M, Krouse ME, Moon S, and Wine JJ (1997) Most basal Isc in Calu-3 human airway cells is bicarbonate-dependent Cl- secretion. Am J Physiol 272: L690L698.
Sheppard DN and Welsh MJ (1999) Structure and function of the CFTR chloride channel. Physiol Rev 79: S23S45.
van der Vliet A, Eiserich JP, Marelich GP, Halliwell B, and Cross CE (1997) Oxidative stress in cystic fibrosis: does it occur and does it matter? Adv Pharmacol 38: 491513.
Walsh MT and Kinsella BT (2000) Regulation of the human prostanoid TP alpha and TP beta receptor isoforms mediated through activation of the EP1 and IP receptors. Br J Pharmacol 131: 601609.[CrossRef][Medline]
Zahler S and Becker BF (1999) Indirect enhancement of
neutrophil activity and adhesion to cultured human umbilical vein endothelial
cells by isoprostanes (iPF2
-III and
iPGE2-III). Prostaglandins Other Lipid
Mediat 57:
319331.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. P. Joy and E. A. Cowley 8-iso-PGE2 Stimulates Anion Efflux from Airway Epithelial Cells via the EP4 Prostanoid Receptor Am. J. Respir. Cell Mol. Biol., February 1, 2008; 38(2): 143 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Seto, C. Hirota, S. Hirota, and L. J. Janssen E-Ring Isoprostanes Stimulate a Cl Conductance in Airway Epithelium via Prostaglandin E2-Selective Prostanoid Receptors Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 88 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Paredes, T. Tazzeo, and L. J. Janssen E-Ring Isoprostane Augments Cholinergic Neurotransmission in Bovine Trachealis via FP Prostanoid Receptors Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, W. Wang, W. Parker, and J. P. Clancy Adenosine Regulation of Cystic Fibrosis Transmembrane Conductance Regulator through Prostenoids in Airway Epithelia Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 600 - 608. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, A. M. Mamoon, and J. M. Farley, Sr. Prostanoids Secreted by Alveolar Macrophages Enhance Ionic Currents in Swine Tracheal Submucosal Gland Cells J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 729 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Clarke, M. G. Belvisi, E. Hardaker, R. Newton, and M. A. Giembycz E-Ring 8-Isoprostanes Are Agonists at EP2- and EP4-Prostanoid Receptors on Human Airway Smooth Muscle Cells and Regulate the Release of Colony-Stimulating Factors by Activating cAMP-Dependent Protein Kinase Mol. Pharmacol., February 1, 2005; 67(2): 383 - 393. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||